RAW 26 de Abril de 2021 - Análisis Picante

  Zhliadnutia 101,495

Warge

Pred 10 dňami

Instagram:
wargeadicto
Facebook:
Wargeadicto
#WWERaw
WWE RAW, también conocido como Monday Night RAW, es un programa de televisión de entretenimiento deportivo de lucha libre profesional producido por la WWE. Se ha transmitido sin interrupciones desde su estreno del 11 de enero de 1993 hasta la fecha, desde Estados Unidos por medio de la cadena USA Network.​ La cadena transmitió el programa desde 1993 hasta el año 2000 cuando fue trasladado a la cadena TNN, más tarde conocida como Spike TV. En 2005, el programa se trasladó y volvió a contar con la cadena USA Network, esta vez con un programa especial llamado "RAW Homecoming".
WWE RAW es generalmente visto como un programa emblemático debido a sus altos índices de audiencia y su formato de transmisión semanal en vivo. Desde su primer episodio, WWE RAW ha sido transmitido en vivo en cerca de 200 escenarios diferentes, más de 160 ciudades y pueblos en nueve países diferentes: Estados Unidos, Canadá, Reino Unido, Afganistán (2005), Irak (2006 y 2007) en el Tributo a las Tropas, Alemania (1997),5​ Japón (2005),6​ Italia (2007)7​ y México (2011).
A partir del episodio número mil, emitido el 23 de julio de 2012, RAW extendió su horario a tres horas de transmisión,​ el cual previamente fue un formato de transmisión exclusivo para eventos especiales.

Komentáre
Brad Schneider 9
Brad Schneider 9 Pred 10 dňami
RAW Número 17 de este 2021 Calificación de este RAW: 0 RAWs con 0: 10 RAWs con 1: 3 RAWs con 2: 2 RAWs con 3: 1 RAWs con 6: 1 Promedio de RAW : 0,94
gaming elsimple
gaming elsimple Pred 4 dňami
Ese 6 .. debió ser 0 ... Creo q warge estaba drogado XD
Ima math
Ima math Pred 5 dňami
Y todavía hay gente que le gusta RAW 2021🤢
Zaid Tyler
Zaid Tyler Pred 7 dňami
@Jeremiah Allen yea, been watching on flixzone for months myself :D
Jeremiah Allen
Jeremiah Allen Pred 7 dňami
Pro trick: you can watch movies on flixzone. I've been using it for watching a lot of movies these days.
M C
M C Pred 9 dňami
Dónde está Unfunfunfunfue Eñunmunmunbue Eome Osas? Nuestro campeón tiene que aparecer
Jose Atlahua Duran Mendoza
Jose Atlahua Duran Mendoza Pred 5 dňami
Gracias.
Claudia Lavayen
Claudia Lavayen Pred 5 dňami
SE VIENE EL R.K.BRO
Urdu Hebreo
Urdu Hebreo Pred 5 dňami
Si todo es tan mierda para ti ¿Porque Sigues Viendo WWE?
Sebastián Galaz
Sebastián Galaz Pred 21 hodinou
Porque debe tener la esperanza de que el de la siguiente semana sea mejor
Panda Jazmín
Panda Jazmín Pred 5 dňami
🐼❤:3 warge !!
Fernando Cruz
Fernando Cruz Pred 5 dňami
¿Cómo se llama la canción de la intro?
Cristian Calderón
Cristian Calderón Pred 5 dňami
2:24 Mujerón Charlotte : )
Fabián Núñez
Fabián Núñez Pred 5 dňami
Nadie: Absolutamente nadie: El borracho recién despertado un 1 de enero después del resacón del 31: 3:06
{Onda RiCh}
{Onda RiCh} Pred 5 dňami
Quien mas esta viendo este vídeo esperando a que warge suba el análisis del smack down del 31 de abril
Golfo Maltés
Golfo Maltés Pred 6 dňami
No veo los shows hace años, solo algún combate esporádico, pero amigo, me parto la caja con usted. Un saludo desde España.
RODRY XD GTO
RODRY XD GTO Pred 6 dňami
Y pa cuando omos y aj he que se los trago westermania 🤔🤔🤔👍😺😸😹
Raul Diaz
Raul Diaz Pred 7 dňami
hay que admitirlo Smackdown es mejor que Raw
Lara Pelayo Luis Eduardo
Lara Pelayo Luis Eduardo Pred 7 dňami
Sheamus lleva como 2 semanas campeón y ya quieren que lo pierda, quien lo entiende ._.
Daniel Sanchez
Daniel Sanchez Pred 7 dňami
*4:56** El lava perros jajajajajajaja.*
pia legizamon
pia legizamon Pred 8 dňami
disculpen warge es gay ? por que la intro
Helio Scanor
Helio Scanor Pred 8 dňami
Diria que paso con AjStyle y omos ,pero es mejor que no esten a que el new mierday los este humillando con sus payasadas
Paul Cruz
Paul Cruz Pred 8 dňami
El relojcito de Bobby es Rolex
Stanley Regalado
Stanley Regalado Pred 8 dňami
Para q putas suben a damian al main rossterr si estaba bien celebrando el campeonato entre putas en un jodido jakusiii🙄
Adrian trejos
Adrian trejos Pred 8 dňami
Rawzzzzzz.
Genecis Tejeda
Genecis Tejeda Pred 8 dňami
Wwe+kpop, grande Warge
Miguel G Hernandez R.
Miguel G Hernandez R. Pred 8 dňami
Alexa me hace recuerdo Calamardo. 🤣😅😂🤣
Miguel G Hernandez R.
Miguel G Hernandez R. Pred 8 dňami
Shaimus me hace recuerdo a Rocky, solo le falsa gritar Dreuw.🤣😅😂🤣
Jesus Manuel
Jesus Manuel Pred 8 dňami
5:04
Jonathan Rodriguez
Jonathan Rodriguez Pred 8 dňami
Lucha de seis pelotudos!!! Cómo amo esa frase.... grande warge saludos desde Bogotá - Colombia
ADAM COLE
ADAM COLE Pred 8 dňami
The fiend después de Wrestlemania bueno perdí no pasa nada y luego de unos cuantos raw desaparece como si nada y no lo volvemos a ver xd
Jesus Daniel
Jesus Daniel Pred 8 dňami
Me encanta cuando dices Humberto Carrillo jajajaja
*Ricardo GD*
*Ricardo GD* Pred 8 dňami
Como pierda bobby lashley tiene racha de 2 en triple amenaza
Angelica Zurita
Angelica Zurita Pred 8 dňami
Dominik misterio:Mira papa warge es mejor que nosotros y es mas famoso. Rey misteryo:Mira hijo nosotros somos mierda ante el. XD
Lord Deimos
Lord Deimos Pred 8 dňami
Esa bruja de Charlotte flair o tiene muy buena suerte o tiene palancas que la desafanen pues la libro por completo y la tenemos de vuelta a seguir fastidiando en especial a mi gran señora aska, que coraje no hay derecho y yo igual le doy un vil 0 a este show de porquería 😠👎
Edgard Vasquez
Edgard Vasquez Pred 8 dňami
Raw es el programa cómico del año
Jose Luis Méndez Suárez
Jose Luis Méndez Suárez Pred 8 dňami
80 años esperando el ceroooooooooooooooooo
Androus Samael Real
Androus Samael Real Pred 8 dňami
Esto es lo más homoerotico que he visto hoy
GUASON
GUASON Pred 8 dňami
Q buen video warge
Miguel
Miguel Pred 9 dňami
8 analisis picante de raw tratando de saber el nombre de la intro
José Durán
José Durán Pred 7 dňami
Mic drop
isaac amaris
isaac amaris Pred 9 dňami
warge saludos, sabes como se llama la cancion que sale al final de los videos que sube la wwe a youtube, es la misma que ponen en el show cuando ponen las luchas en la pantalla gigante o regresan de comerciales, gracias seria de mucha ayuda
Jaz Leon
Jaz Leon Pred 9 dňami
1 puntito por el vergazo con las flores no?
Jeyson Calderón
Jeyson Calderón Pred 9 dňami
Cero merecido, grande Warge
Sarff
Sarff Pred 9 dňami
Primero veo un video que dice que fue un buen raw, luego vengo aquí y raw recibe como siempre un ceroooooooo! jajajaja perfectamente equilibrado, como debe ser
MYeimer Javier
MYeimer Javier Pred 9 dňami
please name song 0:25
Luis Burgos
Luis Burgos Pred 9 dňami
A warge lo banco toda la vida pero que mal gusto para elegir música jajaja!
walter ivar vera castro
walter ivar vera castro Pred 9 dňami
lili troleada raw noche de chicas 😖😖😖😖😖😖😖😖😖😖las luchas aburridas mas femenino wwe todo de chicas😲😲😍😍😲😲😲😲😲😲😲😲😲nooooooooooooo pero las chicas asen locuras wwe😉😉😉😉😉😉😉😉😉😉😉😉😉😉😉
Johsman Sánchez
Johsman Sánchez Pred 9 dňami
"Que piensas que estamos en AEW " la mejor frase de todas.. esto no es un puto carnaval
juan manuel benito berrocal
juan manuel benito berrocal Pred 9 dňami
Si no fuera por Drew Mcityre Alexa Bliss Sheamus y Bobby Lashley con MVP RAW ya es una pérdida de tiempo
SIBJAGA acr
SIBJAGA acr Pred 9 dňami
Jaja me encanta Uuunnnn cceeerrroooo
Juan Díaz
Juan Díaz Pred 9 dňami
Ya es de lo mismo los programas warge
elbicho 73
elbicho 73 Pred 9 dňami
Sinceramente a mí me gustó el RAW de esta semana
Juan Enrique Rodriguez Carreon
Juan Enrique Rodriguez Carreon Pred 9 dňami
En este raw se desperdició Agua, Tomates y flores! Una tristeza 😢
Teresa Bravo
Teresa Bravo Pred 9 dňami
Dominick Daijacovic ahora es un jobber :c
Forcerot
Forcerot Pred 9 dňami
LPM como Jode el ver los pezones de Strowman me hace recordar a las viejas películas de Batman 😂😂😂😂😂
lucha libre Leon
lucha libre Leon Pred 9 dňami
Warge tu si tienes tu boton du youtuber
Keyel Karez
Keyel Karez Pred 9 dňami
roman no necesita a paul, necesita a su primo.
Rosa Pérez
Rosa Pérez Pred 9 dňami
PERDIDA DE TIEMPO UNA CAGADA DE LUCHA BASURA DE MAINT EVENT
Santiago Herrera
Santiago Herrera Pred 9 dňami
2:07 jajaja 6 pelotudos match
Marcelo Urzagasti
Marcelo Urzagasti Pred 9 dňami
Pobre Asuka Yo quiero ver un Asuka vs Io Shirai
jesus bobe
jesus bobe Pred 9 dňami
Baje el volumen
Strike Johan
Strike Johan Pred 9 dňami
Yo le pongo un 0,25. Solo x el momento de Alexa Bliss y Matt Riddle haciendo pareja con Randy Orton q fue gracioso q lo abrazó. Jajajaja. Ojala y le den el título de los Estados Unidos a Humbewtow Cawillow. Jajajaja. Y otra semana más sin saber nada de AJ Styles y Unfunfunfunfue Engonmuemuemue Eoonmeozaz los campeones en pareja. El resto una cagada total reciclaje de la semana pasada. Saludos Dios Warge desde Ecuador panita 🇪🇨🤘
Fabian Fernández
Fabian Fernández Pred 9 dňami
cual es la canicion del principio ?
Néstor Solorzano
Néstor Solorzano Pred 9 dňami
Alexa debería de luchar en ves de hablar tanta mierda....
Jean Carlos Flores De la cruz
Jean Carlos Flores De la cruz Pred 9 dňami
Y, Ay Styles?
Alejandro Rivas
Alejandro Rivas Pred 9 dňami
como me entristece ver a dominik dijakovic de esa manera las épicas peleas que daba en nxt
abraham samano
abraham samano Pred 9 dňami
En qué momento Rhea se convirtio en Hell??
geo yagami
geo yagami Pred 9 dňami
Un programa de M , Vince buquea esto para infantiles como para niño de 5 años que poca lógica narrativa , buqueos perezosos solo me gustó el segmento de Matt riddler con Randy Orton y la semi lucha entre Humberto Carrillo VS sheamus
Carlos Juárez
Carlos Juárez Pred 9 dňami
Desde que empezó el análisis me sospechaba el 0 jajajaja
Marcelo
Marcelo Pred 9 dňami
Lo único rescatable fue RKBro
IVAN RIVERA
IVAN RIVERA Pred 9 dňami
Me gusta escuchar la tipica frace un raw de 💩 y el ceroooooooooooooooooooooooooo😂😅😂😅😂😅😂😅😂😅😂😅😂😅😂😅😂😅😂😅😂😅😂😅😂😅
Natalia jara palma
Natalia jara palma Pred 9 dňami
Quizás por cuánto tiempo no veremos a Bray,ya que cayó en una depresión,el segmento que vimos post Wrestlemania era pregrabado.
Eduardo's Mind
Eduardo's Mind Pred 9 dňami
Mejor que devuelvan a Dijakovic a NXT, se me rompe el corazón verlo hacer el ridículo en el roster principal :'(
Jonathan Osorio
Jonathan Osorio Pred 9 dňami
Se me ocurrio un apodo para morrison caca morrison
Isaac CC
Isaac CC Pred 9 dňami
Y hay que añadir que a the fiend .. Lo dejaron en el olvido.. Yo queria ver su siguiente rivalidad.
César Leos
César Leos Pred 9 dňami
Humbertou carrillouu grande warge
Isaac CC
Isaac CC Pred 9 dňami
Que fresco se le ve a bobby
Ruben Amaya
Ruben Amaya Pred 9 dňami
Ceroooo
Daniel Antonio Gutierrez
Daniel Antonio Gutierrez Pred 9 dňami
WRG IS GOD 🖤 EXCELENTE ANALISIS MI AMIGO !
wilson antonio ramirez martinez
wilson antonio ramirez martinez Pred 9 dňami
Cuando fue la última vez que raw aprobó alguien sabe?
Hugo
Hugo Pred 9 dňami
Análisis picante > Raw
mafiosoregio83
mafiosoregio83 Pred 9 dňami
¡¡¡Lucha 6 PELOTUDOS!!! Jajajajajaja es ya un clásico
julio fariñas
julio fariñas Pred 9 dňami
Que le paso a Charlotte en la cara?😕
Santiago Acosta
Santiago Acosta Pred 9 dňami
Aquí la pregunta es ¿Donde estan Aj Styles y Omos?
Santiago Acosta
Santiago Acosta Pred 9 dňami
Alexa Bliss es lo único que vale la pena de RAW, y sin saber que va a pasar porque Bray Wyatt estará fuera unas semanas porque tiene problemas
Omar G. Bravo
Omar G. Bravo Pred 9 dňami
Un Dream Match que me interesaba era un Drew McIntyre vs Dominic Dijakovic (No T-Bar), pero conforme lo están llevando en el MR, lo veo casi imposible. Aquí Dominic (T-Bar) no es nada de lo que fue en NXT como la mayoría de los que supuestamente "ascienden" al Main Roster.
Alexander Amaya
Alexander Amaya Pred 9 dňami
2:08 6 pelotudos match
Marco Diaz
Marco Diaz Pred 9 dňami
4:42 en español es ReKaBROS jajaja
Ivan Aguilera
Ivan Aguilera Pred 9 dňami
no me deberia de extrañar si vuelven los analisis picante de 5 minutos debido lo penca que han estado los shows semanales...
Adoraciones Sublimes Y de Jubilo
Adoraciones Sublimes Y de Jubilo Pred 9 dňami
La nota es un ceroooooooooouuuuuuuaaaaaaaaaaggggggjjjjjj, excitantes palabras warge. Jajajajajajaja
Andrés Espitia 2003
Andrés Espitia 2003 Pred 9 dňami
Pensé que new mierday y street proshit estaban baneados.
Josue Jimenez Reyes
Josue Jimenez Reyes Pred 9 dňami
En Antes no me interesaba smack down live y RAW era mas entretenido y ahora en RAW me duermo y veo cada detalle de Smack Down
Jean Franco Salazar
Jean Franco Salazar Pred 9 dňami
Pobre miz recibiendo tomates 🍅 🤧💔
the lost
the lost Pred 9 dňami
Wwe por favor si van a hacerle bullying a la pretzel q lo hagan bien pq esos chistes de caídas son más falsos y tan para fetos de 2 meses de embarazo
Kevin Mass
Kevin Mass Pred 9 dňami
Una pena que shelton y cedric sean jobbers
Santiago Matamala
Santiago Matamala Pred 9 dňami
se dieron cuenta que antes de Wrestlemania smackdown era peor que raw pues después de wrestlemania los papeles se invirtieron
Alex Borunda
Alex Borunda Pred 9 dňami
Me agradó la renovación del intro
carlos ibarra
carlos ibarra Pred 9 dňami
warge te imaginas q randy orton le quiera dejar la compañia en los hombro a mat riddler en un futuro
Ferik Dj
Ferik Dj Pred 9 dňami
todo aburre ahora y alexa ya tampoco ayuda porque aburre
Alexander Cornell
Alexander Cornell Pred 9 dňami
Jajaja jajaja tremendo vrgazo que le mete a mandy con las flores, por eso se ganó un punto el programa.
juanto kavalez
juanto kavalez Pred 9 dňami
El de los cartelitos se la fuma de la mala 😅😂
hector gonzalez
hector gonzalez Pred 9 dňami
Ver Wwe porfavor para eso tengo a warge
Marco Diaz
Marco Diaz Pred 9 dňami
2:06 06 pelotudos tag team match, jajaajaa
Alan Rios
Alan Rios Pred 9 dňami
2:05 asi se llamaba el match pero WWE lo edito
Bryan Rodriguez
Bryan Rodriguez Pred 9 dňami
Jjjjja alfin 😂;La nota para este show es un cerooooo👏👏
F Cruz
F Cruz Pred 9 dňami
Carrillo es mejor que Plominik y eso que tienen casi la misma edad
RAW 3 de Mayo de 2021 - Análisis Picante
14:58
WrestleMania 37 Noche 1 - Análisis Picante
19:48
Botella Tras Botella
3:18
Gera Mx - Topic
Zhliadnutia 11 mil.
Stranger Things 4 | ¿Once? ¿Estás escuchando? | Netflix
1:23
Netflix Latinoamérica
Zhliadnutia 326 tis.
RAW 13 de Enero de 2020 - Análisis Picante
12:29
WrestleMania 29 - Vintage Picante
13:33
Warge
Zhliadnutia 79 tis.
WrestleMania 22 - Vintage Picante
21:14
Warge
Zhliadnutia 109 tis.
WrestleMania 28 - Vintage Picante
28:43
Warge
Zhliadnutia 217 tis.
Hugo Savinovich - Entrevista Picante
1:45:28
Warge
Zhliadnutia 364 tis.
Mortal Kombat (2021) | #TeLoResumo
11:01
Te lo resumo
Zhliadnutia 2,2 mil.
Botella Tras Botella
3:18
Gera Mx - Topic
Zhliadnutia 11 mil.
Stranger Things 4 | ¿Once? ¿Estás escuchando? | Netflix
1:23
Netflix Latinoamérica
Zhliadnutia 326 tis.
CHELSEA vs REAL MADRID EN VIVO UEFA CHAMPIONS LEAGUE SEMIFINAL
4:47:48
Analicemos El Show Del Futbol
Zhliadnutia 439 tis.